2015-12-31

Bloggat 2015

Här är några av de mest lästa, kommenterade och/eller intressanta (i mitt tycke) bloggposterna under året som gått.

25 januari: Folk upptäcker woo
Då och då upptäcker yrkestyckare någon skeptisk favorit-fråga och förbluffas, om det nu är av homeopati, spökprat, biodynamik eller något annat. Reaktionerna tenderar att vara övergående.

19 februari: En skeptiker blir lurad
Confirmation bias kallas det när man tror det man vill tro, eller mer precist: När man tror det som passar ens världsbild. Det kan slå hårt och oväntat även mot den mest vältränade skeptiker.

10 mars: IS fejkade flagga
I den svarta flagga som rövargänget i Daesh använder finns vad som sägs vara profetens sigill. Sigillet är en förfalskning.

12 april: Myten om det gyllene snittet
Detta är en riktigt, riktigt spridd och ingrodd myt: Att det gyllene snittet skulle återfinnas i klassisk arkitektur, berömda konstverk med mera.

8 april: SVT "Debatt"
Vanliga skitprogram är inget att uppmärksamma. Ett skitprogram i public service som ger utrymme åt företrädare för vår tids farligaste villolära, säger det irrationella vaccinmotståndet, är värt att uppmärksamma. Detta blev också den mest lästa bloggposten i år. Vilket knappast hade med programmets försvinnande att göra, men good riddance hur som helst ...

26 maj: Faktoid i SAOL
I sin fjortonde utgåva blev SAOL komplett.

12 maj: Svensk scientologi tresiffrig
Denna vrickade obehagliga sekt som gjort och gör så många så illa, som fortfarande bevakas och väcker intresse. Hur många är de egentligen, i exempelvis Sverige? En kvalificerad gissning är 100-200 aktiva utövare.

3 juni: I slutet av kriget
Jag träffar en man som deltog i slutstriden i Berlin.

14 juli: Pluto, planeten som krympte och försvann
Jag firade de första närbilderna på Pluto med att lägga ut ett passande kapitel ur en av mina böcker.

4 augusti: Karmadillo-myten
En man skjuter mot ett bältdjur, kulan rikoschetterar och träffar honom i huvudet. Notismaterial blir världsnyhet när folk får för sig att kulan studsade mot själva djuret ... Vilket den inte gjorde, och inte hade kunnat göra.

1 september: Myten om fusk-ägg
En skröna om kineser som tillverkar konstgjorda ägg slog tydligen an en sträng i folksjälen. För spridning fick den. Håller för en granskning gör den inte.

4 oktober: Hockey-nazisten och andra hakkors
Apropå confirmation bias ... Skulle undertecknad vara immun mot myter, faktoider, skrönor och slikt? Givetvis inte. Den här gick jag på direkt.

18 november: Scientologer i Lomma
Lomma kommun hjälpte företrädare för en av världens farligaste (om än inte största) sekter att nå ut i ett i övrigt respektabelt sammanhang. Knappast av illvilja, det tror jag inte på, men av okunskap. För det är fler än ansvariga på Lomma kommun som inte vet att Droginformation.nu, I SAY NO DRUGS och allt vad de kallar sig är scientologer. Men scientologer är vad de är.

1 december: Den vita skåpbilen
En riktig klassisk klintbergare som jag inte tagit upp tidigare. Har setts i otaliga flöden, artiklar och varningar som på annat sätt sprids av välmenande, och den kommer att fortsätta dyka upp då och då.

6 december: Brun folie
Jag besöker en tomtearmé som bjudit in en skribent från Avpixlat.

Och så en gammal en som otippat fick nytt liv:

3 november 2009: Estniska nazister
Plötsligt vällde besökare in från Ryssland. Och det var denna bloggpost från 2009 de tittade på. Hemläxa i trollfabriken..?

2015-12-30

Slagrutor III

Flertalet av mina läsare veta kanske icke, vad som menas med en slagruta. Jag vill förklara det under ett avlägset och som jag hoppas ohörbart morrande över okunnigheten som trots folkskolor, präster och tungomålstalande ännu vidlåder vårt älskade fosterland. En slagruta är en kvist av ett träd, en kvist bestående av två grenar. Denna kvist kan vara av vad trädslag som helst, men traditionen förmäler att den bäst skäres av flogrönn, d. v. s. en rönn som kommit att slå rot i någon gammal trädstam, alltså en parasitrönn. Flogrönnskvistarna äro effektivast om de skäras under nymånens skimmer. Men det går lika bra med andra trädslag, kanske bäst med vide, näst flogrönn. Jag har sett folk försöka med al- eller tallkvistar. Bäst äro de färska, men gamla män ha försäkrat, att det lyckas även med torrt björkris.

Alltnog — man fattar kvisten, avancerar sakta, och då man passerar en källåder, måste kvisten böja sig nedåt. Man må anstränga sig att hålla emot hur mycket som helst — den sänker sig och går till och med av, om man gör motstånd. Där den sänkt sig, kan man lugnt gräva sin brunn, den måste ge vatten.
- Albert Engström, Slagruta, En bok till (1942)

Slarvigt läst kan stycket ge intryck av att Albert trodde på slagrutor. Så var icke fallet.
- Slagruta! invände jag, berättaren, tror ni på sånt här utåt havet än?

Det blev cirka fem sekunders tystnad. Häradsskrivaren, disponenten och trädgårdsdirektören vidöppnade sina beslöjade ögon och stirrade på tvivlaren. Xylografen, som öppnat sina på glänt, slöt dem igen, medan ett outgrundligt leende spelade under hans gula hängmustascher.

Så häradsskrivaren: - Tror du inte på slagrutan?

- Nej, min gosse, det gör jag inte. Hur vill du förklara, hur vill du inbilla gammalt folk och en gammal kamrat därtill sådant där? Tror du på den?

- Visst fan, därför att jag sett hur den fungerar.
Att han tycker sig behöva beskriva slagrutan för många eller rentav flertalet läsare är intressant. Visste man inte vad en slagruta var på 1940-talet? Eller det lilla "än" i början av det andra citatet. Avses gamla vidskepelser i allmänhet eller är det något mer konkret?

Man kan få för sig att folk "förr" var mer vidskepliga, eller till äventyrs mindre, men det enda som är konstant är att värdelösa påhitt alltid kommit och gått. En kontroll med den stora ugglan visar att slagrutor hade en sorts boom i början av 1900-talet.
Ehuru tidtals tämligen ur bruk, har den dock allt fortfarande anlitats och vid vissa perioder åter kommit i liflig användning äfven in i senare tid. Särskildt blef detta i början af 1900-talet förhållandet i Tyskland, där en litterär strid om slagrutans värde uppstod, och därifrån spred sig rörelsen äfven till Sverige, hvarest slagrutans betydelse ännu för ett eller annat år sedan rätt ifrigt diskuterades. I st. f. de gamla magiska reglerna trädde nu "rationalistiska" sådana, t. ex. att slagrutemannen icke fick bära gummigaloscher, emedan dessa inverkade isolerande. Man hade således mer eller mindre medvetet kommit till den åsikten, att förmågan egentligen icke låg i kvisten, utan fanns hos bäraren, hvilken måste besitta vissa särskilda egenskaper.
- Nordisk familjebok: Slagruta (1917)

Ett fint inlägg i den svenska diskussionen tog jag upp i bloggposten Slagrutor: När ingen mindre än Svante Arrhenius (fysikpriset 1903) genomförde en omsorgsfull undersökning av slagrutans förmåga. Och de "rationalistiska" reglerna återspeglas i Engströms berättelse, där en misslyckad sökning tillskrivs en liten bit kautschuk i rutgängarens hängslen. Man kan bli lite besviken på den neutrala tonen i familjebokens artikel, jämför till exempel med det härligt brutala avfärdandet av homeopatisk "medicin".

Se även bloggposten Slagrutor II för slagrutans äldre historia. Eller för den delen Guld och slagrutor i Dalarna för en ytterst intressant episod från början av 1930-talet, då rentav Aftonbladet, av alla tidningar, varnade för "slagrutemän och andra bedragare".

2015-12-29

Pseudohyllan 2/3

Fortsätter genomgången av pseudohyllan; här är del 1 och del 3:

Li Hongzhi, Kinesisk Falun Gong (Falun Fo Fa Publishing 1998). Mäster Li, grundare återupptäckare av den ... gissa! ... mångtusenåriga läran. Sekten hatas och förföljs av den kommunistiska regimen vilket automatiskt ger pluspoäng, men det hindrar inte att den samtidigt är ytterst förvillad. Deras guru-dyrkan är typisk: "Det finns många mirakulösa berättelser om Mäster Li Hongzhi. Eftersom vanliga människor kanske finner de otroliga, kommer vi inte att berätta mer om dem." Vilket inte hindrar att de beskriver hur han redan som pojke kunde levitera, teleportera, bli osynlig och böja kraftiga järnrör à la Geller: "På den tiden visste han inte vad övernaturliga förmågor var för något. Han trodde att alla kunde göra vad han kunde göra, så han tänkte inte mera på det."

Frank Joseph, The Axis Air Forces (Praeger 2012). Om denna egendomliga bok, och framför allt dess riktigt märklige författare, har jag skrivit i bloggposten Illinois Nazis. Kort: Frank Joseph var son till judiska överlevare och startade i Chicago ett nazistparti. Han sparkades, grundligt, sedan hans bakgrund liksom smak för småpojkar blivit kända. Nu skriver han förvirrade böcker om Atlantis, liksom en och annan bok om kriget där tyskarna får spela hjälterollen.

Norberto R. Keppe, Hälsans ursprung (Proton Editora 2003). Om Keppes märkliga sekt har jag skrivit i Analytisk trilogi och (på engelska) The Keppe Cult. Här redogör mästaren själv för hans syn på hälsa och ohälsa. Det är en svårläst samling beskäftiga analyser, späckade med Keppes egna termer; jag är inte säker på vilka poänger myntandet av nya begrepp anses ha, men det återkommer i andra sekter, inte minst scientologin.

Henry Kjellson och Carl-Anton Mattsson, Teknik i forntiden (Valentin 1995). Boken utgörs dels av Kjellsons verk Forntidens teknik (1956) och Försvunnen teknik (1961), dels av Mattssons fördjupningar och mer eller mindre relaterade sidospår. Kjellson kan beskrivas som en svensk föregångare till von Däniken, där forntida folk i kreativa tolkningar tillskrivs modern eller rentav framtida teknik (dock utan ancient aliens-temat). Mattsson, som än idag är aktiv i UFO Sverige, beskriver fornegyptiska borrmaskiner, en radioaktiv Moses, tibetanska lamor som skapar gravitationsupphävande vågor medelst ljud, med mera.

David King, Drömmen om Atlantis (Månpocket 2006). Denna trevliga bok sprider inte villfarelser utan beskriver en man som, bland mycket annat, gjorde det. Nu ägnade sig förvisso Olof Rudbeck åt såväl kloka och förnuftiga saker som blandade vansinnesprojekt, och bland de senare utmärkte sig inte Atlantis; att drömlandet hamnat i titeln har utan tvivel med marknadsföring att göra. Originalets titel var förresten Finding Atlantis, det är intressant att läsa hur en utlänning beskriver svenska förhållanden.

Göran Lambertz, Quickologi (Fri Tanke 2015). Justitierådets försvarstal går ut på att Quickfallet inte är någon rättsskandal. Domarna är korrekta; "domstolarna gjorde rätt som fällde Thomas Quick på grundval av den bevisning som presenterades". Detta tuggas om och om igen. Som jämförelse hade jag Dan Josefssons Mannen som slutade ljuga (Lind Co 2013), som accentuerar allt det bisarra i den cirkus som utgjorde (utgör..?) "Quicklaget" med Lambertz & co. Innan jag läste Lambertz bok kommenterade jag fallet och i synnerhet det annars förträffliga förlaget Fri Tankes beslut att ge ut Lambertz i bloggposten Göran Lambertz tänker fritt.

Verner Lindblom, Götland — Sveriges vagga? (Skaraborgs-Bygden, 1982). Lindblom är en i raden av västgötaskolans stridbara, lokalpatriotiska och yviga förkunnare. Han var en av Dag Stålsjös konsulter när denne skapade sin ökända tv-serie Svearikets vagga. I detta verk går han igenom flera aspekter av Sveriges äldsta myter och centralorter, framför allt hur alltihop kan placeras i Västergötland.

Bertil Lundman, Dala-allmogens antropologi (Almqvist & Wiksell 1945). Lundmans doktorsavhandling är resultatet av omfattande undersökningar i Dalarna och är klassisk rasbiologi; kanske den sista avhandlingen i den stilen i det här landet? Icke desto mindre blev Lundman docent i fysisk antropologi på Uppsala universitet 1947 och undervisade för fullt fram till 1970 (läser jag hos Eva F. Dahlgren, Min farfar var rasbiologi). Jag har tagit upp en detalj ur boken i bloggposten Ett litet stamträd med bara Dalarna. Bokens förste ägare, fil. lic. K-G Nyholm, har fått den signerad av författaren, men icke desto mindre finns det en hel del ouppsprättade sidor i de tyngre avsnitten.

2015-12-28

Lördagsfråga 392: Karlaberg

  1. Om man släpper nålar på ett golv, och håller reda på hur många av nålarna som snuddar vid linjen mellan två bräder, så får man så småningom ett närmevärde till pi. Denna märklighet kallas Buffons nålar efter den store naturalisten de Buffon som lanserade problemet, dock utan att känna till kopplingen till pi. Det är en så kallad Monte Carlo-metod, ett mycket användbart sätt att angripa matematiska problem. Här finns även en faktoid koppling, när den italienske matematikern Mario Lazzarini 1901 gjorde 3408 nålkast och fick fram ett mycket bättre värde på pi än vad som var matematiskt möjligt; han fuskade alltså.
  2. Karlbergs slott i Solna, återgiven i storverket Suecia antiqua et hodierna som man aldrig tröttnar på. "Thess Hvita Lustslott" blev med tiden militärhögskola och är det än idag, faktiskt världens äldsta oflyttade.
  3. Tavlan är inte av någon holländsk mästare från 1600-talet, utan en österrikare från 1800-talet: Eduard Charlemont.
  4. Carlsberg i Köpenhamn fick sin elefantport 1901 då svastikan var en populär lyckosymbol. Elefanterna var bryggeridirektör Jacobsens egen idé, inspirerad av ett känt monument i Rom som ärligt talat ser lite misslyckat ut.
Monte Carlo (efter Karl III, prins av Monaco), Karlberg, Charlemont och Carlsberg ger, tja, karlberg. Den lätte satte Pölsan.



2015-12-27

Sveriges första kvinnliga partiledare

Här har vi Sveriges första kvinnliga partiledare: Vera Oredsson. Partiet hette Nordiska Rikspartiet. Inriktningen framgår av bilden. Hon blev medlem 1960 och gifte sig med grundaren Göran Assar Oredsson (han på bilden), som hon efterträdde på posten 1975. Där blev hon till 1978 då Göran åter blev partiledare.

Jag vet inte hur man ska tolka det men i Görans dödsruna, publicerad av tidningen Realisten (som drevs av Svenskarnas parti och lades ner 2014), nämndes att NRP "hade sin storhetstid på 1970-talet".

I Veras CV återfinner man även uppgifter som att hon föddes Schimanski i Berlin 1928. Hennes bror är den mer kände Folke. Deras pappa var med i SA och själv var hon, som alla flickor i hennes ålder, med i Bund Deutscher Mädel, den kvinnliga motsvarigheten till Hitler-Jugend. I krigets april 1945 kom Vera, Folke och deras svenska mamma med en av Bernadottes vita bussar till Sverige. Några år senare gifte sig Vera med den 25 år äldre Sven-Olov Lindholm, en av vårt lands mest namnkunniga nazister.

Nordiska Rikspartiet torde vara mest känt för sin insats i denna bild:
I bloggposten Tanten som slog nazisten nämnde jag en anledning som den ålderstigne Göran tog upp när han 2009 lade ner partiet:
Redan efter 2006 års val och Sverigedemokraternas valframgångar ville jag att NRP skulle upphöra och kunde för framtiden utröna den ojämna kamp NRP skulle få utkämpa i jämförelse med de resurser till miljonbelopp som nu skulle stå till SD:s förfogande.
- Göran A. Oredsson i ett brev till tidningen Expo

Wikipedia: Vera Oredsson

2015-12-25

Juldagspub med VoF Göteborg

När det är fullmåne så håller VoF Göteborg, den lokala avdelningen av den skeptiska föreningen, skeptisk pub. Eftersom fullmåne inträffar just idag så blir det också skeptisk pub. På vanliga stället Haket, Masthuggstorget. Folk börjar strömma till efter kl 18. Det blir en skeptisk kvart om epigenetik också. Så det är bara att dyka upp.

2015-12-24

Långbens popcorn

Varifrån kommer Långbens popcorn?

1. Långben hugger åt sig sin majskolv.

2. Han fastnar med gaffeln i ett vägguttag en lampsockel och får en stöt ...

3. ... Som poppar majsen till popcorn.

4. Långben äter popcorn istället för majs.

Avsnittet där Långben stoppar gaffeln i uttaget plockades bort inför julen 1982 eftersom man var oroliga för att barn skulle inspireras till att göra likadant.

Bilder ur Mickey's Trailer (1938). Bonus: Långbens röst görs av Pinto Colvig, samme man som var aracuan i Clown of the Jungle.

2015-12-23

Pseudohyllan 1/3

Jag har inventerat bokhyllan för pseudovetenskap, myter och slikt. Debunkarna har en egen hylla, liksom mina egna verk. De följande titlarna är, med några undantag, outspädda förvillare.

Här är del 2 och del 3.

Myter och mysterier (Det Bästa 1984) & Tage la Cour, Myter och mysterier (Bra Böcker 1973). Två typiska verk i vad som en gång var en vanlig och rumsren genre; här kan man se att folkbildande, debunkande och motarbetande av förvillare åtminstone fått viss verkan. Särskilt i den första blandas händelser och påståenden friskt utan att ifrågasätta i onödan. La Cour går igenom färre historier lite ordentligare, med tyngdpunkten på de kriminalhistorier som var hans främsta gebit.

Bill Anderton, Nostradamus — hans liv och profetior (Wahlströms 1998). Eftersom varje pseudohylla måste ha en bok om Nostradamus. Denna tar profetiorna på fullkomligt allvar.

N. O. Bergqvist, Ymdogat — Atlantis! (Svenska böcker, 1971). Om man bara studerar världskänt trams i miljonupplagor så kan man få för sig att allt trams säljer. Så är förvisso inte fallet. På varje Berlitz och von Däniken går härskaror av bortglömda förhoppningsfulla. De tänkte ut, "forskade" fram, skrev ner och publicerade sina alster, för att bli berömda eller åtminstone få gensvar (minnes Hjalmar Söderbergs behovstrappa) och gärna tjäna en hacka; men det enda resultatet blev tystnad och makulatur. Bergqvists Ymdogat (efter Ymer, Doggers bank och Atlantis) är Atlantis i Nordsjön med högteknologiska invånare som förebilder för senare tiders gudar. En sökning på titeln ger träffar hos Bokbörsen, Antikvariat.net och Tradera, och ingen annanstans. Priserna är inte upphetsande.

Charles Berlitz, Dödens triangel (A&K 1976). En modern klassiker, för det var denna bok som gjorde Bermuda-trianglen, påhittad några år tidigare, till allmängods. Jag har detaljgranskat myten på Faktoider.nu: Bermuda-triangeln.

Claus Bjerring, Det nya Kina (Tiden 1975). En barnbok som enkelt, pedagogiskt och genomoptimistiskt förklarar skillnaderna på det gamla och nya Kina. Mening vald på måfå: "På daghemmen uppträder barnen med sång och dans i små teaterpjäser, som berättar om arbetet i jordbruket och i industrin, om partiet och om ordförande Mao."

James Churchward, Cosmic Forces of Mu (London 1934). Churchward uppfann (i princip) Mu, som är för Stilla havet vad Lemurien är för Indiska oceanen och Atlantis för Atlanten. Källorna uppges vara uråldriga indiska texter som knappt någon annan sett eller kunnat läsa. Forces är hans fjärde bok och en tröttsam uppvisning i diverse pseudoläror rörande kosmologi, biologi, fysik ... Där den gemensamma faktorn är att dessa läror är den sanning som man kände till på Mu.

Erich von Däniken, Stenarnas mystik (Wahlströms 1992) och Mina bevis (Berghs 1977). Jag har ännu inte fördjupat mig i von Dänikens underbara värld, där den viktigaste (men långtifrån enda) delen utgörs av att civilisationen grundades av utomjordingar. Han hade väl sin storhetstid på 1970-talet men är fortfarande ett stort namn i vissa kretsar. Jag vet inte hur många som följer Giorgiou A. Tsoukalos pseudovetenskapliga uppvisningar i "Ancient Aliens" som känner till von Däniken, men det borde de göra. (Inte för att von Däniken var först med idén.)

Hanns Fischer, Die Sintflut und Hörbigers Welteislehre (Koehler & Amelang, Leipzig 1924). Ett verk i den lilla och oerhört säregna genre som Hörbigers världsislära (begreppet återkommer i många titlar) genererade. Jag tog upp ämnet i kapitlet "Ockult nazism" i Tredje rikets myter (Forum 2010). I just denna bok förklarar Fischer den verkliga syndafloden, de spår den lämnat efter sig i geologi, historia m.m., och hur den förorsakades av att vår dåtida måne störtade ner på jorden.

Lars Gahrn, Slaget vid Herrevadsbro och hägringar vid Häradsvad (Mölndal 2004). Förvisso inget förvillande utan rena motsatsen: Gahrn disputerade på sin avhandling mot västgötaskolan och har fortsatt på det spåret. Här reder han ut lokaliseringen av ett viktigt medeltida slag som några sena generationer försökt att placera i Västergötland istället för korrekta Västmanland.

2015-12-22

Distansromantiker

Io vidi monna Vanna e monna Bice
Venire inver lo loco là 'v'io era,
L'una appresso de l'altra miriviglia
- Dante Alighieri får en glimt av Beatrice med väninnor, "det ena undret efter det andra", i La Vita Nuovo

Dantes mycket diskreta romans på distans med Beatrice hör till allmänbildningen. Om den självbiografiska La Vita Nuovo ("Det nya livet") är att lita på så såg han henne precis två gånger: Första gången när han var nio år, andra gången när han var 18. Redan detta har gjort folk misstänksamma; är det en slump att Dantes "förhållande" med Beatrice delas in i perioder om nio år, säger kvadraten på det heliga tretalet? Sju år senare dog Beatrice, återigen enligt Dante.

Eftersom källäget beträffande florentinska medborgare från tiden (utöver de allra märkvärdigaste) inte precis är heltäckande, och Dantes ledtrådar så få och vaga, är det långtifrån självklart vem som avses eller ens om Beatrice var en fysisk person. Boccaccio pekade ut en viss Beatrice di Folco Portinari som Dantes Bice, och det är fortfarande den vanligaste identifikationen.

Lucevan li occhi suoi più che la stella
- Inferno, canto II

Oavsett vem eller om hon var så kom hon att göra långt större avtryck i litteraturen än i livet. Här träffas hon och Dante helt kort i början av Inferno. Sedan återses de i paradiset (bara en sån grej...) där hon övertar Vergilius roll som guide.

Hade en existerande Beatrice minsta aning om att Dante existerade? Gissningsvis inte, även om jag verkligen inte vet.

Stefanie Rabatsch levde i österrikiska Linz i början av 1900-talet.
En gång fick jag ett brev från någon som skrev att han gick på konstakademien, men att jag skulle vänta på honom, han skulle komma tillbaka och gifta sig med mig. Jag minns inte mer av brevet, eller om och i så fall hur det var undertecknat. Men jag hade ingen aning om vem som hade skickat det.
Långt senare blev hon upplyst om hennes hemlige beundrares identitet: en tonårig Adolf Hitler. Vår främsta källa beträffande denna historia utgörs annars av Hitlers barndomsvän August Kubizek som bland annat nämner att Hitler ofta pratade om henne, aldrig med henne. Liksom att han skickade ut Kubizek att spana på och hopsamla information om den eftertraktade, som Hitler dittills inte ens känt till namnet på.

En enda omständighet gör denna distans-romans mycket intressantare än Dantes patetiska trånande: Stefanies flicknamn var det synnerligen judiska Isak.

Nu var visserligen inte Stefanie av judisk börd. Men det visste inte Hitler. Och vid den här tiden brydde han sig heller inte om det.
Had Hitler summoned up the courage to talk to her, the course of history might have been very different.
- Paul Roland, Nazi Women: The Attraction of Evil (Arcturus 2014)

Inte för att jag är mycket för kontrafaktisk historia. Men ändå.

2015-12-21

Lördagsfråga 391: Kvarkar

  1. Ellie och Carl träffas i Pixars Up (2009).
  2. Daniil Charms heter detta charmtroll. Han skrev avantgardistisk litteratur i den tidiga Sovjetunion där sådant gick för sig.
  3. En tongansk 1-pa'anga med Taufaʻahau Tupou IV. Valutans namn kommer från en sorts ärtor som man använde som pärlor. Enligt en historia ska den förste tonganen som såg mynt ha trott att det var värdelöst krimskrams, den vite mannens pa'anga, och namnet har hängt kvar. Dess internationella kod är TOP.
  4. Stone Temple Pilots Scott Weiland, R. I. P., i Down.
  5. Den professionelle våghalsen Johnny Strange, R. I. P.
  6. Titania i trans över den åsnehövdade Botten Vävare. En midsommarnattsdröm, såklart.
Upp-ner, charm-sär, topp-botten; kvarkar, såklart. Visste Pölsa Dum det? Såklart.

2015-12-20

Hur datorer blev en killgrej

Häromdagen läste jag en kolumn som fick mig att fundera.
När blev datorer och programmering en killgrej? Vem bestämde det?

Svaret hittar jag i NPR:s podcast "Planet Money: When women stopped coding". Och svaret är nästan exakt 1984. Innan dess var kvinnorna de främsta programmerarna – killarna var mer intresserade av att bygga strömkretsar och hade lämnat mjukvarufältet öppet för kvinnliga snillen. Men 1984. Då kom de första persondatorerna och lanserades som "leksaker för pojkar". Föräldrarna köpte det rakt av och boom, så hade killarna fått flera hundra timmars programmerande innan tjejerna ens hade fått ett eget login.
- Hillevi Wahl, Sluta ge tjejer Nobelpris i glädje, Metro 16 december 2015

(En detalj: De första datorerna som var överkomliga för privatpersoner, för hobby- och/eller kontorsbruk, kom i mitten/slutet av 70-talet. Några modeller och år som utmärker sig är den i USA oerhört populära Apple II 1977, IBM PC 1981, Commodore 64 1982, och Apple Macintosh 1984. Sådana datorer började bli heta i Sverige (och "därom kan jag ge besked/om herrn så vill, ty jag var med") omkring 1980, eller några år efter USA.)

Hur som helst. Två påståenden görs:
  • Fram till början av 1980-talet var datorer unisex, eller hade rentav haft en kvinnlig övervikt beträffande programmering.
  • I början av 1980-talet bestämde sig försäljare och reklamfolk för att hemdatorer var en killgrej.
En podcast anges som källa. Här har vi den:
A lot of computing pioneers — the people who programmed the first digital computers — were women. And for decades, the number of women studying computer science was growing faster than the number of men. But in 1984, something changed. The percentage of women in computer science flattened, and then plunged, even as the share of women in other technical and professional fields kept rising.
- Planet Money: When Women Stopped Coding, NPR 21 oktober 2014

Obs, länken ovan går till en längre text med en nedklippt podd (under 5 min). Det finns förvirrande nog även en annan version When Women Stopped Coding, NPR 17 oktober 2014, med kortare text men längre (17 min) podd.

De tar upp flera fall där kvinnor som var nyfikna på datorer och började läsa datavetenskap i början/mitten av 1980-talet upptäckte att alla manliga studenter på kurserna redan kunde en hel del om hur maskinerna fungerade eftersom de hade datorer hemma. Flickor hade sällan hemdatorer eftersom de (dyra) grejorna marknadsfördes som leksaker åt pojkar, med många män och killar i annonserna, desto färre tjejer och kvinnor (och då som morsor, bikinibrudar eller andra staffagefigurer). Att de marknadsfördes som killgrejor berodde just på att de sågs som leksaker: "like toys everywhere, there was a strong gender preference". Detta fick föräldrar att endast förse sina söner med datorer, vilket i sin tur är den enda anledningen till att datorer än idag har en avsevärd manlig dominans. Får vi veta ... Är det sant?

Här är ovan nämnda diagram, med andel kvinnliga studenter i computer science i rött:

Inte mycket att snacka om? Jag har inte sett rådata för att bedöma om exempelvis datavetenskap fick betydligt fler studenter från början av 1980-talet. Notera att högskolorna länge var manliga bastioner oavsett ämne ... Eftersom det just inte fanns några andra tillfällen att börja ägna sig åt programmering ö h t förrän mot slutet av 1970-talet som sagt så var en manlig dominans vad man kunde förvänta sig.

Hur grabbig var då datareklamen vid den tiden?



Det är inte svårt att hitta enstaka exempel på reklam som är bättre än det intryck podcasten fått. Även om det grabbiga förvisso är norm.

Men formade reklamen verkligheten, eller anpassade den sig efter den? Var inte den maskulina dominansen i datorernas värld fullkomlig även på den här tiden?

Vi börjar från början. Så här kunde det se ut på 1940-talet:

När omfattande beräkningar behövde göras har man sedan urminnes tider fått ta till folk, kallade räknare eller på engelska computers. Utöver matematiska färdigheter krävdes noggrannhet och tålamod, arbetet var långtråkigt och som regel illa betalt; kort sagt, ett kvinnoyrke. Så småningom fick de maskiner till hjälp, som på bilden ovan en så kallad differentialanalysator (mer en elektrisk räknesnurra än en dator-prototyp). De två räknarna till vänster heter Kathleen McNulty och Betty Holberton. Båda skulle några år senare få arbeta med ENIAC.

Jean Bartik och Frances Spence vid ENIAC. Det föll sig naturligt att de som arbetat som räknare, för hand eller maskinellt, fick ansvaret för motsvarande arbete på de programmerbara elektronhjärnorna. Den mest kända var Grace Hopper som programmerade Harvards Mark I vid samma tid, för att några år senare skapa den allra första kompilatorn (typ) och vara med om att ta fram specarna för högnivåspråket COBOL.
[Intervjuaren]: There were quite a few women there doing programming?
Shutt: They were all women. In the office where I worked, the only male was a very handicapped young man with cerebral palsy. He was the only male in that office. They were all women. The women who had worked the desk calculators were now programming ENIAC, and ORDVAC, and EDVAC. But that's because it was left over from the war; it was the "Rosie the Riveter syndrome" still.
- Pionjären Elsie Shutt intervjuas av Janet Abbate 2001 för IEEE History Center, Hoboken, NJ, USA

Men sedan? När kriget tagit slut och skaror av ingenjörer och framtida programmerare återvänt till det civila, och datormarknaden samtidigt påbörjat sin hisnande utveckling?

Podcasten tog upp några enstaka fall så vi kan göra detsamma.

Här är en del av personalen på det historiska datorprojektet på Institute of Advanced Study, Princeton, 1952.

Ingenjörsgänget från samma projekt, de som tänkte ut och byggde hårdvaran. Längst till höger nyckelpersonen John von Neumann, vars namn fortfarande används om arkitekturen på den mojäng som du läser denna text med. (Och nr 5 fr.v. är institutets dåvarande chef, J. Robert Oppenheimer.)

Elsie Shutt igen. Hon startade 1958 Computations, Inc. (CompInc), ett av de första mjukvaruföretagen över huvud taget. De anställda var alla kvinnor som jobbade hemifrån. Företaget fick en rad uppdrag, även inom försvaret och NASA. (I den länkade intervjun finns fantastiska beskrivningar av arbetet med tidens ångdatorer, rekommenderas varmt!)
So how did women go from being the centre of the computing world, the pioneers of the industry, to being sidelined?
- Planet Money-podden

Men även om det inte är svårt att hitta mängder av kvinnor i datavärlden så verkar det som om det bara var de allra första åren som de var många och tongivande. Shutts firma var undantaget, inte regeln. Det var därför den blev omskriven (som i Business Week 1963).
By that time [i mitten av 1950-talet], in Clippinger’s department at Raytheon, it was about 50 percent men and 50 percent women — and it really amazed me that these men were programmers, because I thought it was women’s work! Isn’t that interesting? The women who were there [were] women who had learned to program in that first wave, which I was in at Aberdeen.
- Elsie Shutt, ibid.
My feeling is: first it was all women, and then it was fewer women, and now it’s more equal. [...] The thing that I say that surprises everyone is that I thought it was a woman’s field at first, and I do think it was. And then men discovered that it was really interesting.
- Elsie Shutt, ibid.

Ett namn som nämns i förbigående får sin förklaring på en annan plats:
Interestingly, Shirley abbreviated her first name to 'Steve' in business transactions and found herself getting better responses. It was only when Shirley was face-to-face with clients that they realised she was female. Her identity as 'Steve', which would have indicated male-ness to the unknowing, would then have had an impact on her success as a software entrepreneur. This suggests that computing was already beginning to take a masculine tone, despite historians suggesting that computer science was stereotyped as feminine in the mid-19th [...skrivfel för 1900-talet..?] century.
- Tasnuva Bindi, Women didn’t just recently start coding, they actually STOPPED coding decades ago, Startup Daily 24 februari 2015

 Margaret Hamilton basade för utvecklingen av Apollo-programmets mjukvara.
Then, as now, “the guys” dominated tech and engineering. Like female coders in today’s diversity-challenged tech industry, Hamilton was an outlier.
- Robert McMillan, Her Code Got Humans on the Moon — And Invented Software Itself, Wired 13 oktober 2015

Så: Vad som än hände med sökande till datavetenskap i början av 1980-talet så förefaller det allt som om datorer vid den tiden länge varit en killgrej.

Å andra sidan fanns det, den grabbiga hackerkulturen till trots, inte så få framstående kvinnliga förmågor i facket. Jag hade ingen aning om att man på 1960-talet kunde hitta tillräckligt med hemmafruar som ville och kunde programmera tidens minidatorer och mainframes för att driva ett bolag. Och att de flesta av de tidiga programmerarna var kvinnor torde få känna till. Mycket att gräva i och fundera på, som sagt.

2015-12-18

Chex eller kex?

benämning på små torra, hårda l. möra (o. täta) kakor (med indifferent smak), vanl. av fint vetemjöl, vilka ofta förtäras med smör, ost, marmelad o. d.; ofta koll. [kollektiv betydelse = man äter kex, mer sällan ett kex]
- SAOB: KÄX

Jomen, i ordbokens artikel från 1939 stavas det med ä (med senare tiders "kex" inlagt i rött). Den stavningen ser man inte ofta nuförtiden. Och så får vi veta att det uttalas
käk⁴s, stundom med eng. uttal, äv. ɟäk⁴s
och är därmed framme vid huvudfrågan: Heter det kex eller chex? Och varför uttalas det olika?

Kex är ett lån från engelska cakes (och cake har engelskan i sin tur lånat från fornnordiskan). Det äldsta belägget är från Kajsa Wargs kokbok 1755. De kexen verkar närmast motsvara pepparkakor: "ett slags i pastejformar l. på papper gräddade kakor med deg av smör, mjöl, ägg, socker, tillsatt med vissa kryddor (kanel, kardemumma, suckat, muskotblomma m. m.)". SAOB nämner också den fina stavningen kakes, bestämd form caksen.

Uttalets geografi är lite osäker. I artiklar dras enkla gränser som att "chex" främst hör hemma i södra och västra Sverige. När folk redogör för uttal + hemort verkar det inte fullt lika enkelt. Om frågan inte kartlagts ordentligt förut så finns här ett prima uppslag för en studie i ett mycket litet men förvånansvärt engagerande ämne.


Hur uttalades det då från början?

Fredrik Lindström tror, vet ej på vilka grunder, att mjukt k "chex" var det som först tillämpades på det nya ordet. Det stämmer med den svenska regeln att k när det kommer före e (som är en mjuk eller främre vokal) uttalas "mjukt", som i kedja, kelig och kemi. Undantagen är inte så få, som kebab, keps och kefir, men då är det lånord (som keps från engelska cap) som (ännu) inte fått sitt uttal försvenskat.

Där har jag en fundering som enkom bygger på löst grubblande: Säg att det första uttalet var hårt "kex", som i originalet (desto troligare som språket förr i tiden främst förmedlades muntligen). Om lånordet först slog igenom i södra och västra Sverige, så har det i de landsdelarna haft mest tid på sig att smälta in i språket och anpassas till vår fonetik. Det osvenskt hårda k:et har bevarats i de trakter där ordet är nyare. — Skulle det kunna stämma?


Uppdaterat: Blev tipsad om denna fina utbredningskarta, uträknad av lingvisten Mikael Parkvall.
Frågan är förstås bara om ordet nådde västkusten innan det nådde östkusten (vilket såklart är geografiskt rimligt) eller om regeln [att k uppmjukas före e] avskaffades tidigare i Stockholm än i Göteborg. Bådadera skulle ju logiskt sett kunna förklara följande mönster.
- Mikael Parkvall, Skräpmat nu på kartan, Lingvistbloggen 6 augusti 2010

2015-12-17

Svenska helgon


När SVT först lade ut nyheten om Elisabeth Hesselblad blev rubriken "Sverige får sitt andra helgon". Efter en stund korrigerades det ... Men korrekt är det fortfarande inte.
Det krävdes bokstavligen mirakel för att hon skulle bli helgon – och nu får Elisabeth Hesselblad glorian runt sitt huvud som den andra svenskan någonsin.
- Mirakel krävdes för att få glorian runt huvudet, Expressen 16 december 2015

För det finns fler svenska helgon än Birgitta. Exakt hur många beror faktiskt på hur man räknar.

A. I. Transkovskij, Jaroslav den vise och den svenska prinsessan Ingegerd

Det första svenska helgonet hette Ingegerd Olofsdotter. Pappa Olof var ingen mindre än Skötkonung, som inte var landets förste kristne kung men väl den förste att förbli kristen livet ut (hans företrädare och far tröttnade fort efter sitt dop). Hon är visserligen inte helgonförklarad i den katolska kyrkan men väl i den ryska ortodoxa. Där kallas hon den heliga Anna och firas den 10 februari och den 4 oktober. Det finns även en församling uppkallad efter henne i Sverige, den serbisk-ortodoxa kyrkan Heliga Annas ortodoxa församling med verksamhet på flera ställen.

Se även Dick Harrisson: Det första svenska helgonet, SvD 12 november 2015, eller läs Catharina Ingelman-Sundbergs Mäktig mans kvinna (Richters 2001).

Här har vi Elin av Skövde, skyddshelgon för Västergötland i allmänhet och Skövde i synnerhet. Hon förekommer även på kommunens vapen. Noga räknat blev hon inte kanoniserad men väl saligförklarad, steget nedanför.

Här har vi en högst osäker illustration av den tämligen okände Willehad dansken, hur man nu vill räkna någon som kommer från Ystad under den danska tiden. Han kanoniserades av Pius IX den 29 juni 1867 tillsammans med 18 andra i en grupp kallad martyrerna från Gorkum.

Utöver ändrade gränser och olika kyrkors respektive kanoniseringar så är huvudproblemet det som rör Elin med många fler: Att definitionen på helgon länge inte var så hård som man kan tro.
– I Danmark behövde den heliga personen vara helgonförklarad av påven för att firas officiellt av kyrkan. Det krävdes inte i Sverige. Här kunde en from person accepteras som helgon av kyrkan utan påvens sanktion, säger Sara Ellis Nilsson, Göteborgs universitet, som skrivit en avhandling om helgonkulter under tidig medeltid i Sverige och Danmark.
- Många lokala svenska helgon, SvD den 28 februari 2015


Wikipedia: Svenska helgon

Tipstack till Fabian N.

2015-12-16

Star Wars

Den 16 januari 1980 besökte Stjärnornas krig* Mupparna. Fyra månader före premiären av Rymdimperiet slår tillbaka hade man en given anledning till att synas i det mycket populära tv-programmet. Någon kommenterade någonstans att Mupparna vid den tiden var mer kända än rymdkrigarna vilket mycket väl kan stämma.

Jag ser att jag tagit upp filmen några gånger tidigare på bloggen och hemsidan.
I Rymdimperiet slår tillbaka utvecklar sig Stjärnornas Krig (ni vet, Star Wars) till något av ett släktdrama när Darth Vader erkänner faderskapet för sin klentrogne son. Att det kollektiva minnet lyckats vränga till en så här enkel replik, om än aldrig så lite, är ännu ett tecken på faktoidernas makt, ifall det skulle behövas. Ovanstående citat ["Luke, I am your father"] är aningen käckare och användbarare än det fullt korrekta ["No. I am your father."], vilket nog är anledningen till dess större spridning.
- faktoider.nu: "Luke, I am your father"

Här jämförs den exploderande dödsstjärnan i de två olika versionerna  Jedins återkomst:
Den tillagda effekten verkar, otippat nog, komma från Star Trek:
Ringen kallas för Praxis shockwave eller Praxis effect, efter en måne i ett annat "universum" som exploderar med just en sådan.
- Faktoider: Explosions-ringar

Okej, den här pärlan får ni också. Den är faktiskt bättre än Episode I.


* Att jag föredrar den svenska titeln beror dels på att jag växte upp med den, dels att den låter bättre. Däremot är originalet onekligen lättare att få till grafiskt.

2015-12-15

Tidningen Free

Alla dessa tidningar och fler därtill finns på issuu.com/tidningenfree

... Free från förnuft, sans och logik. Free, eller Energivågen som den hette fram till 2009, är en gratistidning som bevakar new age-fältet, och ser framför allt till att köpare och säljare i den branschen hittar varandra. Den delas ut i butiker som Vattumannen (Stockholm) och Regnbågen (Göteborg). Om du bor någon annanstans, men vet något ställe där de kränger kristaller, rökelse och tarot-lekar, för att inte tala om böcker om andlighet, reinkarnation, mysticism och så vidare; då vet du förmodligen ett ställe där den hugade kan förse sig med Free.

En sådan publikation kan läsas av flera anledningar. En är att få exempel på tokerier som folk tror på. En lite ambitiösare är att få hjälp med att bilda sig en uppfattning om vad som rör sig i den godtrogna sektorn. Här presenteras nya läror och galenskaper, böcker, läromästare, tokar och galningar, en ständig ström av splitter nya urgamla visdomar ... Och inte minst är det intressant att se vilka läror det inte skrivs om.

Att det är en gratistidning innebär att en stor del är uppenbara annonser, resten mindre uppenbara annonser. I sammanhanget spelar skillnaden mellan betalt utrymme och redaktionell text ingen större roll; om ingen längre annonserar för en lära, skola, kursgård eller något undermedel, så är ju det en indikation så god som någon på att intresset är svalt.

Därför blir det särskilt intressant att bläddra i äldre exemplar av tidningen. Inte för att de jag hittat är särskilt ålderstigna i sammanhanget. Energivågen började ges ut 1982 och har faktiskt hållit igång ända sedan dess. Det hade varit riktigt intressant att få tag på de allra tidigaste årgångarna; vad var hett i början/mitten av 1980-talet, vilka kvackare var i ropet, vilka böcker löste världsproblemen?

Men det som finns utlagt är vackert så. På issuu.com/tidningenfree, som sagt, finns i skrivande stund över 40 tidningar från 2008 och framåt, för den som vill forska i woo.

Läs om:
  • Vidskeplig turism i "Kung Arthurs rike", trakten som rymmer platser som Avebury och Glastonbury m.fl. (Jan-feb 2009).
  • Stor guide till spikmattor! (Jan-feb 2010) Vart nu de tagit vägen...
  • Nov-dec 2012 var ett temanummer om hur Maya-kalenderns påhittade profetior skulle slå in.
  • Benny Rosenqvist låtsas vara medial i nummer efter nummer ("Var ljusvarelsen min bror?" "Ja." osv).
  • Flera artiklar (t.ex. i jul-aug 2009) och många annonser för "Reconnective Healing", ett pyramidspel för vidskepliga som var stort för ett par år sedan.
  • Satyam Frank Hougen, här ej kallad "mannen som ännu inte sålt sin Ferrari", intervjuas (sep-okt 2009). Jo, för samma år kunde man läsa om hur Änglakurser betalar för guruns lyxbilar, Expressen 24 november 2009.
  • Med appen iAura, bara 15 spänn på iTunes, kan du fotografera folks auror för att få besked om "den där nya tjejen på jobbet kommer att funka i gänget", eller om "den där datorn som du är övertygad om är besatt av djävulen". (Jul-aug 2010).
Med mycket, mycket mer. Ej för hjärtsvaga verklighetskramare.

2015-12-14

Lördagsfråga 390: DNA

  1. Wilkins Runway är en flygplats i Antarktis som togs i bruk 2008.
  2. Sir John Franklin ledde en expedition som skulle försöka hitta nordvästpassagen men försvann. Den gav upphov till en lång rad räddnings- och sökexpeditioner som utökade vårt arktiska vetande långt mer än vad den första expeditionen hade kunnat.
  3. Watson. Så klart.
  4. Den svårt sjuka Nancy Crick fick dödshjälp 2002. Efteråt fann man att hon inte längre hade cancer, utan plågades av annat.
Om (Maurice) Wilkins och (Rosalind) Franklin inte räckte så fanns (James) Watson och (Francis) Crick: Fyra av de som, med mer gemensamma krafter än vad som passar myten om det ensamma geniet, kom fram till hur DNA, den underbaraste av molekyler, är funtad.

Här är Pölsans svar:

ATGTGGATCCTTAAAATAAACTCCTTTCGAGGAAATAAGCTCATTAACTGGGCGACAAGTCAAAATTGCCGGATCTGTAAATAG

ATG är inte bara AB Trav och Galopp utan i sammanhanget metionin, ett så kallat "startkodon" som indikerar början på en sekvens. Därefter hittar vi TGG som ger tryptofan som kan förkortas Trp eller ännu kortare W. Sedan isoleucin Ile eller I. Eller för att ta hela tiraden:

WILKINSFRANKLINWATSQNCRICK

Se, det var ett svar!

2015-12-13

Dagens viktigaste mål

Det är inte bara i Sverige som man fått för sig att frukosten är dagens viktigaste mål ...

Huruvida påståendet är sant är en sak, som kostvetare och -tyckare av alla grader engagerar sig i. En annan fråga, som är lättare att sitta och gräva i på kammaren, är hur gammalt det är, och varifrån det kommer.

Jag vet inte hur gammal folk tror att uppfattningen är. Själv har jag ingen aning, men lite förvånad blev jag ändå när jag utan vidare hittade belägg som detta i The Bryan Daily Eagle (Texas) från den 8 maj 1912, där frukosten inte bara är dagens utan livets viktigaste mål.

Eller ett inlägg i nykterhetsdebatten i Iron County Register (Missouri) den 3 november 1887.

Så även om Kellogg, Nestlé, Arla med flera aktörer i Big Breakfast givetvis dragit nytta av uppfattningen så är det inte de som myntat den.

När kom idén till Sverige tro? För denna meningsbyggnad ser man sällan numer:
Dagens viktigaste mål - middagen
- SvD, 7 april 1923

Av de glimtar ur arkiven man får på tidningar.kb.se kan man se att åtminstone pressen hakat på några decennier längre fram:
Frukosten är dagens viktigaste mål
- Aftonbladet, 28 juli 1970


Från början av 1970-talet hittar man betydligt fler belägg för påståendet på svensk mark än innan. Vad hände då? Fick Arla snurr på någon reklamkampanj, eller vad..?

2015-12-11

Den första lucian

Fritz von Dardel visar hur luciafirandet gick till på Kobergs slott, söder om Trollhättan, 1848 (Wikimedia).

Jag vet inte om detta är den allra första lussebruden som fastnat på bild men bra tidig är den. Det allra äldsta kända belägget över huvud taget lär vara från 1764, då lussefrukost i Västergötland serverades av ...
... Ett hvit-klädt fruntimmer med gördel om lifvet, liksom en vinge på hvardera axeln, stora itända ljus i hwar sin stora silfversljusstake, som sattes på bordet, och strax derpå kom en annan med ett litet dukadt bord, försedt med allehanda kräseliga, äteliga och våtvaror, som nedsattes mitt för sängarna ...
(Källan för denna uppgift uppges enligt Wikipedia (sv.): Lucia vara C. Fr. Nyman, Märkvärdigheter från Ingelstads härad (otryckt).  Jag har i hastigheten inte hittat fler uppgifter om verket än dessa knapphändiga. Carl Fredrik Nyman levde och skrev i häradet 1745-1818 så han har åtminstone existerat.)

Seden fick någorlunda spridning i området kring Vänern (den regionuppdelningen ser man inte alltför ofta) i början av 1800-talet.
Luciafirandet synes egentligen ha tillhört Värmland, Dalsland, Västergötland, Bohuslän och Halland, men finnes ock omnämndt från Småland, Östergötland, Södermanland, Närke och Västmanland [dit vi snart återkommer] och har icke varit obekant äfven i andra landskap.
- Nordisk Familjebok (1912): Lucia

Låt oss nu ta en titt på denna bild. Baksidestexten lyder "Studerande Brag såsom Lucia 1875. Lund". Den blev nyligen upptäckt och omskriven.
Varje år kring jul blossar debatten upp: Vilka som ”får” och ”inte får” vara Lucia. Nu kommer nya uppgifter från den anrika universitetsstaden Lund, där en kulturintendent nu tror sig ha hittat ett 140 år gammalt bevis för att stadens första Lucia var en man.
- Okända bilden visar: Första lucian kan ha varit man, SVT 9 december 2015

För det första har flera rubriksättare, såväl på SVT (som borde veta bättre) som Metro lockats att framställa nyheten som om den första lucian var en man. När det i själva verket är en lucia från 1875.
Då Luciafirandet år 1875 var en relativt ny företeelse anser intendent Jansson att bilden visar stadens allra första Lucia, och eftersom traditioner ofta haft sitt ursprung i universitetsstäderna Lund och Uppsala kan det också vara här som Luciatraditionen startat.
Om indentent Jansson tror att Heribert Brag kan ha varit den första lucian i Lund så stämmer det nog. (Anledningen var så enkel som att kvinnliga studenter inte fanns.) Fast det som står om att luciatraditionen kanske startat i Lund och Uppsala tror jag inte indententen sagt, eftersom det inte alls stämmer. Man kan även jämföra med följande fina upplysning; familjebokens "fortfarande" ska nog tolkas som vore seden en medeltida kvarleva, snarare än en tämligen färsk studentikos förlustelse.
Några nationsföreningar vid de svenska universiteten fira fortfarande "Lussedagen" med utklädnad och arla dryckeslag.
- Nordisk familjebok (1886): Lucia

För det andra så finns det betydligt äldre belägg för åtminstone en manlig lucia.
Dubbeldörrarna till förstugan uppslogos, och in trädde en dräng klädd i hvitt lakan, med en krans af ljus på hufvudet och bärande en väldig bål med glöggus. Egentligen borde det varit en tjenstflicka, ty han skulle föreställa Sancta Lucia, men, förmodligen för bördans skull, hade därtill i senare tider tagits en karl.
- En bruksinspektor berättar från Skinnskatteberg, Västmanland 1820, enligt Hilding Celander, "Lucia och lussebrud i Värmland", Svenska kulturbilder (1936)

Denna nyhet har cirkulerat varje Lucia de senaste åren, se till exempel En lucia kan se ut hur som helst i Expressen den 5 december 2014. Många verkar missa uppgiften om att man först "i senare tider" tagit till en karl.

2015-12-10

Turings maskin


Mike Davey: A Turing Machine in the Classical Style

On Computable Numbers från 1936 (han säger fel år i filmen men det står rätt på hemsidan) är en av de riktigt klassiska avhandlingarna som hör till den lite djupare allmänbildningen. Den ska man känna till (om än inte behärska, det är en helt annan sak...) oavsett hur intresserad eller ointresserad man är av matematik eller datorer. För Turingmaskiner är inte bara något som än idag lärs ut inom logik och relaterade ämnen, utan i princip de grunkor som gör det möjligt för dig att läsa det som du läser just nu. Bland mycket, mycket annat.

"...A machine which..."

För det vi ser här är, i princip, datamaskinens andliga födelse: En tankekonstruktion och matematisk modell skapad av Alan Turing. Syftet var att lösa ett knivigt talteoretiskt problem som säkert sysselsatte flera dussin matematiker vid den här tiden ... Ja, den siffran hittade jag på, men det är ett faktum att talteori och matematisk logik var en smal och udda kvist på matematikens träd, ansedd som den renaste, mest världsfrånvända matematik som tänkts ut, rentav ännu mer så än topologin.
When I was a student, even the topologists regarded mathematical logicians as living in outer space
- Martin Davis (1928-)
Thank God that number theory is unsullied by any application
- Leonard Dickson (1874-1954)

Det dröjde emellertid inte länge innan Turing fann ett användningsområde som kanske någon skulle vara intresserad av och rentav betala en slant för: chiffrering och dechiffrering. Han funderade på att tota ihop en praktiskt taget oknäckbar chiffermaskin och sälja den till brittiska staten. Men så kom kriget, och han togs i tjänst ändå ... Fast den historien känner ni nog till.

Och sedan dess har man hittat fler användningsområden, för talteori och Turings maskin i dess många olika inkarnationer.

2015-12-09

Nobel AI

Idag har det varit AI för hela slanten. I nobelt sällskap dessutom.

Nobel Week Dialogue arrangeras den 9 december varje år (dan före dan) som en del i Nobelveckan. Varannan gång håller man till i Stockholm, varannan i Göteborg. I år var det på hemmaplan, och med ett så spännande tema som artificiell intelligens dessutom. Då har man liksom inget val.

På plats fanns ett halvdussin nobelpristagare, en bunt andra experter och forskarkändisar, lite löst folk i övrigt (som en minister). Den som stod ut för min del var Raymond Kurzweil, geni och mångsysslare, som visserligen även ägnar sig åt singulariteten (Faktoider: Myten om AI-katastrofen) men vars framtidsvisioner i övrigt nog har lite mer substans.
Nobel Week Dialogue är en del av Nobelstiftelsens aktiviteter inför Nobelprisceremonin i dag [detta kommer ut i papperstidningen den 10 december] och på årets seminarium bjöds forskare inom medvetande, informationsteknologi och medicin in för att prata om artificiell intelligens. Bland andra stod Sherry Turkle, inflytelserik sociolog, och Barbara Grosz, forskare inom datavetenskap, och May-Britt och Edvard Moser, förra årets nobelpristagare i medicin, på scen tillsammans med många andra kända forskare och nobelpristagare.
- Artificiell intelligens inger hopp och oro, GP 9 december 2015

Det blev en rad korta dragningar och seminarier om intelligens i allmänhet och artificiell sådan i synnerhet, om läget nu och i framtiden, om robotar, hur vi tänker, uppfattar världen, och lär oss saker, hur man får maskiner att tänka, uppfatta världen och lära sig saker, singulariteten, hur folk och m.e.m. tänkande maskiner kan tänkas samarbeta, och så vidare. Givet formatet blev det med nödvändighet rätt ytligt, men med det här persongalleriet blev det mestadels nog så intressant ändå, och det sades en hel del som var direkt klipskt.

Foto: @NobelPrize

Den mest bejublade gästen var Frank Wilczek, trots att han satt hemma i Massachusetts. Han deltog på distans med hjälp av en rullande uppkopplad skärm med kamera. Att kunna se och prata med folk på en annan ort är ju just ingen nyhet, men att dessutom kunna röra sig gav en närvarokänsla som till att börja med kändes oerhört märklig, berättade han. Men han vande sig snart, och kände sig på något diffust sätt som om han verkligen var på två platser samtidigt. På bilden Olafur Eliasson, isländsk konstnär som är Nobel-aktuell med ett speciellt konstverk, som tar en selfie med Frank; May-Britt Moser; Max Tegmark, svenskamerikansk kosmolog.

En särskilt bra grej var hanteringen av Twitter. Publiken fick inte bara en hashtag, utan man bevakade verkligen vad som skrevs och rapporterade då och då om intressanta frågor, kommentarer, vilka citat som retweetats mest osv. Åtminstone ett par av de populäraste citaten fick egna bilder, som det ovan.


2015-12-08

Kameruns avbytarbänk


Det ser mörkt ut på Kameruns avbytarbänk ...
- Arne Hegerfors..?

När ett omdiskuterat citat genererar uppemot 100 (i skrivande stund) sidor på Flashback så vet man att det kan vara värt att gräva i.

Här gäller det ett mycket känt citat, en klassiker bland alla dessa "sportgrodor" med ofta tvivelaktig härstamning. Det sades inte för hundra år sedan utan 1990, i en tid då såväl televisionsbolag som vanligt folk spelade in även långt obskyrare material än kvartsfinaler i fotbolls-VM. Och så är upphovsmannen dels känd för sina maniska lustifikationer, dels i livet.


Här berättar han om när Kamerun (som i gruppspelet drämt till med en seger mot självaste Argentina) mötte England och var så nära att gå vidare till en sensationell semifinal ... Men det ville sig inte. Och då, säger Arne, fällde han kommentaren: "Jag var ju totalt omedveten om att jag hade sagt någonting som var det minsta roligt i det sammanhanget."

Men sade han det över huvud taget? Om han gjorde det, så måste klippet finnas tillgängligt, om inte hos SVT (det grymtas en del i Fb-tråden om censur, på vanligt manér) så definitivt på diverse VHS-kassetter ute i stugorna. Eller hur..?

Eller så här: När man trots det utomordentliga källäget inte kan få fram citatet, vad kan man säga om det då? Annat än att grodan verkar vara en anka?

Nästa steg är att leta reda på äldsta belägg. Och det visar sig vara Lasse Anrell 1995. Då är vi på fastare faktoid mark, för Anrell har ett grundmurat dåligt rykte som källa. Hypotesen för tillfället är att det inte sades av Hegerfors 1990 utan tillskrevs Hegerfors av Anrell 1995.

Att ännu ett påhittat citat behandlats som vore det äkta, trots att det 1) har exakt källa angiven och 2) är enkelt att bekräfta för den som har tillgång till den sortes material, är nu inget originellt. Det intressantaste i sammanhanget är att den påstådde upphovsmannen själv gått på historien; om han är ärlig, vilket jag förutsätter. För så starka kan goda faktoider verkligen vara.

Flashback: Myten kring "det ser mörkt ut på Kameruns avbytarbänk"

Tipstack till Erik D.

2015-12-07

Lördagsfråga 389: Canidae

  1. Friedensreich Hundertwasser var en österrikisk arkitekt som ogillade raka linjer och räta vinklar. Detta typiska Hundertwasser-hus ligger i Wien. (Han är dock intressantare än så, se WP-artiklen.)
  2. Denna colavagn är en Goggomobil, från Glas fabrik i bajerska Dingolfing.
  3. William Fox (1879-1952), grundare av filmbolag som han så småningom förlorade kontrollen över. Men hans namn lever kvar i 20th Century Fox, Fox News osv.
  4. Det senaste Wolfenstein-spelet (Wolfenstein: The Old Blood) kom ut 2015. Det mest kända måtte fortfarande vara Wolfenstein 3D från 1992. Det på bilden är det första: Castle Wolfenstein från 1981 på en Apple II. Inte för att jag vet om man kan räkna dem till "samma serie" bara för namnets skull. Då är det mer anmärkningsvärt om '81 års Wolfenstein verkligen var det första dataspelet som utspelades under andra världskriget.
Hund, dingo, räv och varg. Jag väntar på en förklaring från Josef K om det var det han menade.

2015-12-06

Brun folie


Cui Bono bjuder in Jan Sjunnesson. Vilka vem?

Cui Bono (lat. "vem gagnar det?") är en förening i Göteborg som sprider så mycket ovetande de orkar. Ju underligare och osannolikare desto bättre: chemtrails, "elallergi", kvacksalveri i allmänhet, konspirationsteorier osv. Allt har inte en politisk vinkling men när en sådan förekommer ligger den tydligt åt höger. Även om detta fascistflum delar många frågor med den mjukare opolitiska woo man oftare stöter på, så behöver man inte lyssna länge för att inse att något är annorlunda. T.ex. skulle en "Nej till NATO"-pamflett se synnerligen malplacerad ut bland kristalltanterna på Harmoni-expo eller Hälsa och livsstilsmässan.

Jan Sjunnesson är en skribent som skriver på Avpixlat. Han och SD verkar ha en komplicerad relation. Här ett smakprov på hans alster, när han inte fick pressackreditering för SD:s "landsdagar" i Lund häromveckan utan istället gick på konsert med Ultima Thule:
En höjdpunkt var dock när Marcus Öhrn äntrade scenen och ropade att han skulle sjunga den låt som Sveriges nästa statsminister brukar kompa honom på – Fädernesland. Allt slutade med allsång av vår nationalsång och stor förbrödring bland de ganska påstrukna besökarna. Många skinnvästar och grymma Sverigevänner verkade nöjda och skrek "Thule, Thule, Thule".
Vilken kombo! Vad kan gå fel?


En del av gratismaterialet: Ett nummer av Nya Tider (vet inte om den är Nationaldemokraternas till namnet eller bara till gagnet), ett budskap från Folkkampen mot NATO, en pamflett från pålitliga Vaken.se, skrämselpropaganda mot HPV-vaccinet, ett blad från "elallergikerna" på "Strålskyddsstiftelsen", varningar för fluor och "information" om 9/11.

Anarchos förlag, vars utgivning enklast kan beskrivas som att David Icke inte sticker ut nämnvärt, fanns på plats. Hos dem investerade jag i den lilla men hisnande knasiga boken 2012 i fickformat (2011) om 2012 års m.e.m. maya-relaterade profetior, vars pris så här efter apokalypsen fallit till överkomliga 10:-. (Formatet till trots verkar den vara något av en encyklopedi i tokerier, jag hittade åtskilligt jag aldrig hört talas om.) Hos dem kunde man förresten se skylten "Vi tar kort" vilket var märkligare än det låter, för enligt Cui Bono är kortbetalningar ännu ett av Maktens medel mot folket:
Om ingenting görs nu så kommer vi plötsligt att vakna upp i ett samhälle där våra kontanter är utbytta mot enbart digital valuta, t.o.m. i form av RFID-CHIP!
VI TÄNKER INTE STÅ FÖR ETT SAMHÄLLE DÄR VÅRA BARN SKALL BLI PÅTVINGADE RFID-CHIP.
- Manifestation till kontanternas skyddande, Cui Bono 14 april 2015

Kvällen introducerades av en förmåga från Cui Bono. Först undrade han hur publiken fått reda på föreläsningen: hemsida, affischering ... Eller kanske via GP..? (Skratt; för publiken vet att en mainstream-tidning som GP inte skulle ta i Cui Bono med tång.)

Sedan tog Jan Sjunnesson ordet, "folkbildaren, författaren och Avpixlat-medarbetaren". Ämnet för kvällen var yttrandefrihet. Han påminde om att tryckfrihetsförordningen fyllde 249 år just den dagen. Och så fick vi en historisk översikt av folk som använt sig av yttrandefriheten och fått skit för det, som Sokrates och Jesus. Liksom arbetarrörelsen, som i sin motarbetade barndom inte fick mötas i etablissemangets lokaler. Vad gjorde man då? Träffades utomhus (s.k. vägmöten) eller, när man fått lite snurr på rörelsen, byggde egna samlingslokaler, kända som Folkets hus.

Vid samma punkt befann sig de nu, konstaterade Sjunnesson. Om han avsåg något särskilt parti, Cui Bono eller någon kombination därav framgick inte.

För Sjunnesson hade minsann varit med om att bli motarbetad, utestängd från etablissemangets lokaler. Som när den kontroversielle Karl-Olov Arnstberg bjöds in av Cui Bono till en lokal de bokat i stadsbiblioteket, men fick se den avbokad sedan stadsbiblioteket insett vad Arnstberg gick för. Något som sedan spillde över på Cui Bono och Sjunnesson. Eller de gånger han stött på patrull när han försökt arrangera dragningar med Lars Vilks.

Motståndarna är den rabiata vänstern, den tanklösa, virriga, aggressiva och märkvärdigt mäktiga. Detta gjordes mycket tydligt.

Vetenskapliga tvister gick han inte så mycket in på, men så är sådant heller inte hans grej på samma sätt som Cui Bonos. I förbigående nämndes Sverigevänner, islamkritiker och klimatskeptiker som orädda sanningssägare av samma slag; som till exempel klimatskeptikern Lars Bern, som Sjunnesson är personlig vän med.

Han sade även bra saker. Som att det fysiska mötet (mötesfrihet är ju nära släkt med yttrandefrihet) aldrig helt går att ersätta med det virtuella. Eller att man i en debatt lär sig att vässa sina argument; den som aldrig behöver försvara sin åsikt kommer att bli väldigt dålig på att försvara sin åsikt när det väl gäller. Eller att den som berättar eller skriver något kommer på saker efterhand; det är inte ett enkelt omvandlande av tankar till ljud/bokstäver utan en process där det kan hända saker under tiden.

En del av detta må låta som klichéer, men de framfördes på ett mer skärpt och övertygande sätt än man brukar se.

Om yttrandefrihet var kvällens ena röda tråd så var Sverige den andra. Om Sverige och svenskarna förefaller Sjunnesson veta hur mycket som helst, hur vi är, vad vi egentligen tycker och tänker, och så vidare, och inte minst hur vi är jämfört med resten av världen. Nog är det fantastiskt hur Sjunnesson, och många med honom, kan världens ca 200 länder tillräckligt bra för att veta exakt hur de skiljer sig från Sverige? Och på hur fantastiskt många punkter har vi inte lyckats göra oss unika?

Svensken är beredd att sälja ut sin yttrandefrihet till förmån för trygghet. Som åtminstone tanken var i Sovjet, så länge det gick. Att folk inte brinner mer för sanningen beror inte på att de är bedragna eller så (en av Cui Bonos käpphästar) utan på att de faktiskt inte bryr sig om sanningen särskilt mycket.

Vidare har vi haft en lång tradition av en god stat, svag men välmenande. När denna omsider växte sig långt starkare och inte alltid lika välvillig så hängde tron på den goda staten kvar. Därav den tydligen för svensken så typiska auktoritetstron (det finns mycket som är typiskt för svensken!), vare sig auktoriteterna är politiker, präster eller vetenskapsmän.

Vad dagens politiska kultur i Sverige beträffar så fick vi veta att den kännetecknas av glada eller direkt barnsliga amatörer, och har gjort så sedan ca 80-talet. Fram tills dess var politiken, även den S-märkta som ju var den som gällde, präglad av ett ingenjörstänk av samma slag som en gång gjorde Sverige stort. Sannerligen inte alltid välvilligt eller arbetandes för goda krafter, men nyktert och åtminstone strävande efter effektivitet och kompetens. Palme må ha varit en förvirrad socialist, men han hade åtminstone utbildning, talets gåva och slips. — Vilket ska jämföras med dagens "Bolibompa" (det uttrycket användes): urblåsta vuxenbarn som lallar om HTBQ, postmodernism och andra icke-frågor.

Beträffande mångkultur så ses den av förespråkarna som ett samhälle som är öppnare, där fler strömningar tillåts. Men se där biter de sig i svansen, menade Sjunnesson. För ju fler grupper som får komma till tals, som kvinnor, muslimer och så vidare (dessa exempel nämndes), desto fler blir det som kan bli kränkta. Och ju fler som man inte får kränka, desto försiktigare och mindre öppet blir samhället.

Sjunnesson har, som ofta verkar vara fallet med de som brinner för politik, en varierande politisk bakgrund. Han har varit såväl yvig ockupantsocialist som folkpartist. Sådant som ligger i det förflutna kan visserligen vara förlåtet. Publiken kan ha haft svårare att smälta att han kungjorde sig vara sionist; även om jag aldrig blir klok på förhållandet mellan de som ser juden resp islam som den största fienden så förefaller Cui Bono vara emot båda. Än pinsammare blev det när en publikfråga drog upp en rad av deras hjärtefrågor, som chemtrails, Monsanto, GMO, elstrålning, TTIP, heroin-Kosovo (just så), alternativmedicin etc, och gjorde ett till fråga förklätt påstående om det inte var en konspiration som var anledningen till att de inte togs upp i media? Där konstaterade Sjunnesson svalt att "det var många frågor" (underförstått: de har inte med varandra att göra), att flera av dem verkligen tas upp även bland mainstream media, och att han inte trodde att tystnaden i övrigt berodde på någon konspiration. Journalister (som det handlade om just då) är inte illvilliga, menade Sjunnesson; de vill väl men kan, av någon anledning, inte bättre. Vilket går stick i stäv mot den uppfattning som är förhärskande inom "sanningsrörelsen" med Vaken.se, Cui Bono och allt vad de heter.

För att försöka sammanfatta kvällen med Jan Sjunnesson hos Cui Bono: Det finns likheter och olikheter mellan fascisterna och foliehattarna. Så länge båda rörelserna är små kommer likheterna att få dem att dras till varandra. Om någon av dem, eller båda, växer sig större så kommer olikheterna att bli allt mer besvärande för dem. Vilket väl är det enda positiva som kan sägas om ett sådant framtidsscenario: att tokstollarna av olika slag så småningom upptäcker att de faktiskt inte trivs med varandra.

Såväl Sjunnessons dragning som frågestunden efteråt filmades.

Youtube: Yttrandefrihet med Jan Sjunnesson, 2015-12-02


2015-12-04

Ivar Lo om kvack

Ivar Lo-Johanssons storverk (i flera bemärkelser) Statarna rymmer en lång rad berättelser om lidande och elände av alla de slag. Även kvacksalveriet har fått ett kapitel: Järnextraktet.
Från de svenska fornsagorna lever berättelsen hur man lät kungasöner förtära varghjärtan för att de skulle få mod och bli oövervinnliga i krig. Från de sörmländska slättstatarna i början av nittonhundratalet lever bara det tragiska minnet av järnextraktet, som de åt för att de skulle bli starka.
Med vårtröttheten följde längtan. Järnextraktet slog fullständigt igenom på våren samma år. Då åt män, kvinnor och barn av det, emedan det ansågs innehålla koncentrerad solkraft, som var nog för att skapa oöverskådlig lycka åt människorna.
Mest var det männen, som sände efter av extraktet. De hade det med sig i eskorna* på åkern, satte sig ned under ekarna och tog en skedudd till maten, till blåmjölken** och den spickna sillen. Snart skulle verkan komma. Snart skulle mannakraften strömma till dem – åkern bli ett Eden, musklerna svälla av kraft, jorden komma att bli en grön äng, på vilken sköna kvinnor och vilda hästar lustvandrade.
- Ivar Lo-Johansson, Statarna: Järnextraktet (1936)

Obs länken. Historien finns tillgänglig på nätet (i bökiga Litteraturbanken men ändå) och är så kort och bra att jag inte vill skriva mer om den här. Gå och läs! Särskilt om du inte läst något av Lo-Johansson förut, det är en brist i allmänbildningen som är överstökad på några minuter.

Så kanske berättelsen om järnextraktet dyker upp i skallen på dig med, närhelst du läser om smarta människor som kommit på hur de ska skaffa sig hälsa & styrka, i synnerhet de som inte vill lägga ut pengar i onödan.
Tillverka ditt eget kolloidala silver
Genom att själv göra/tillverka kolloidalt silver är du garanterad att erhålla bästa kvalitet (förutsatt att du har riktiga kunskaper om produktionsmetoden). Det är inte svårt att tillverka kolloidalt silver. Det är förvånadsvärt enkelt.
- Källa: Nätet.

* Av sammanhanget framgår att "eskorna" är någon sorts motsvarighet till Unica-boxar. Men jag har inte hittat ordet i någon ny eller gammal SAOL/B. Felinläst..? [Uppdaterat: Men det löste sig med mina fina läsare, se kommentarerna för förklaring]

** Blåmjölk är skummjölk, ännu tunnare än vår tids lättmjölk. [Minimjölk, som Pölsan nämnde]

2015-12-03

Alfahannar

Begreppet "alfahanne" myntades efter studier av just vargar. Men senare har man kommit på att även om det kan användas om andra djur så gäller det inte just vargar.
Alfa är det grekiska alfabetets första bokstav och uttrycket alfahanne härstammar från vargarna. Vargen är – till skillnad från exempelvis lo och räv – ett flockdjur. Alfahannen i en flock är ledaren, han och hans alfatik är det enda par som får föröka sig i flocken. Även om alfahannen råkar vara en ovanligt elak och hänsynslös best, så är han, precis som i den mänskliga världen, den som de andra flockmedlemmarna följer och åtlyder.
- Männen är alfahannar och omegamän i vår tid, Aftonbladet 1 augusti 2008

Begreppen lanserades av en viss Rudolf Schenkel i studien Expressions Studies of Wolves (1947). Den som så småningom fick spridning på dem, till den grad att de dyker upp även i AB, hette David L. Mech, en vargexpert mest känd för boken The Wolf: The Ecology and Behavior of an Endangered Species (1970).

Senare insåg bl.a. Mech att han och Schenkel utgått från ett vinklat underlag. De studerade inte vilda vargflockar utan flockar i djurparker (vilket kunde vara nog så besvärligt). De vargarna hade fösts ihop i mer eller mindre vuxen ålder. När man studerade riktiga vargflockar så fann man att dessa, till skillnad från vad man tidigare trodde (vilket är värt att poängtera) inte var tillfälligt hopfösta som skolklasser, arbetsplatser eller plutoner, utan utgjorde familjer. Det innebar att konceptet alfa, beta osv. fick ses över, åtminstone vad vargarna beträffar.
[Mech] formally disavowed this terminology in 1999, explaining that it was heavily based on the behavior of captive packs consisting of unrelated individuals, an error reflecting the once prevailing view that wild pack formation occurred in winter among independent gray wolves (Omegas). Later research on wild gray wolves revealed that the pack is usually a family consisting of a breeding pair and its offspring of the previous 1–3 years.
- Wikipedia: Alpha (ethology)

Eller som Mech själv skriver i sin sammanfattning av 1999 års paper, min markering:
The above observations show that, at least in summer, social interactions among wolf-pack members are not very different in intensity or quality from those among members of any other group of related individuals. Even the much-touted wolf dominance hierarchy is primarily a natural reflection of the age, sex, and reproductive structure of the group, with the breeding male dominating all others posturally and the breeding female garnering food from the male while she is tending young pups.

The typical wolf pack, then, should be viewed as a family with the adult parents guiding the activities of the group and sharing group leadership in a division-of-labor system in which the female predominates primarily in such activities as pup care and defense and the male primarily during foraging and food-provisioning and the travels associated with them (L.D. Mech, see footnote).
- David L. Mech, (1999) "Alpha status, dominance, and division of labor in wolf packs". Canadian Journal of Zoology 77 (8): 1196–1203

Så trots att begreppet alfahanne först användes om vargar så gäller det inte just vargar.