2015-12-12

Lördagsfråga 390



11 kommentarer:

Josef K sa...


Min kompass pekar söderut.

Hexmaster sa...

Din kompass pekar fel. Svaret ligger mycket, mycket närmare.

Josef K sa...

Men förstör helgen för mig då!

:)

Pölsa Dum sa...

Genomskådat:

ATGUGGAUCCUUAAAAUAAACUCCUUUCGAGGAAAUAAGCUCAUUAACUGGGCGACAAGUCAAAAUUGCCGGAUCUGUAAATAG, även om glutaminet fick mutera bort ett streck.

Christian sa...

Det räckte ju med Watson för att jag skulle misstänka DNA. Pölsas vackra sång bekräftar nog denna gissning utan att jag ens försöker identifiera övriga bilder. :)

Pölsa Dum sa...

Det är inte en sång, det är en kod :) Klura vidare hur den ska läsas!




... och jag hoppas jag har stavat rätt, annars blir alla sura.

Hexmaster sa...

I am become Lördagsfrågan, the Destroyer of Weekends.

Hexmaster sa...

Pölsan har satt den. Det enda i övrigt jag fått fram om koden är att T:et inte platsar bland alla U:n.

Pölsa Dum sa...

Det beror på att jag med andan i handen och väskan i halsen hade halkat till fel molekyl. U är ju i RNA, inte DNA, vet ju varenda skolunge!

Så kan det gå när man inte har sett en endaste molekyl på snart trettio år utan är siffernörd i stället för labbnörd :)

ATGTGGATCCTTAAAATAAACTCCTTTCGAGGAAATAAGCTCATTAACTGGGCGACAAGTCAAAATTGCCGGATCTGTAAATAG är DNA-versionen, men svaren blir desamma och det ska väl vara tryptofan om det inte räcker som upplysin så att någon av ala nin andra ser in-nebörden.

Pölsa Dum sa...

Lite lättare nu:

Förutom att börja och sluta sekvensen tillverkar koden Tryptofan-Isoleucin-Leucin-Lysin-Isoleucin-Asparagin-Serin-Fenyalanin-Arginin-Alanin-Asparagin-Lysin-Leucin-Isoleucin-Asparagin-Tryptofan-Alanin-Treonin-Serin-Glutamin-Asparagin-Cystein-Arginin-Isoleucin-Cystein-Lysin, och den som använder enbokstavsförkortingarna kan läsa svaret, med Q för O då.

Pölsa Dum sa...

WILKINSFRANKLINWATSQNCRICK, alltså.